View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_150 (Length: 337)
Name: NF11737A_low_150
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_150 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 321; Significance: 0; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 3 - 331
Target Start/End: Complemental strand, 23358536 - 23358208
Alignment:
| Q |
3 |
ataatactcatcctttttgtacacaaaatcgacgttgaataatggaacatgtttcaatttttgtgtagcagcgaaacgaataccattgaaaggtccactt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358536 |
ataatactcatcctttttgtacacaaaatcgacgttgaataatggaacatgttttaatttttgtgtagcagcgaaacgaataccattgaaaggtccactt |
23358437 |
T |
|
| Q |
103 |
ctgtatatcatcgacgaaccattccttatctccgattcaggattgtcacttcttatgtagccataagtcgtttgacccgaagaagggtcatcccaattct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358436 |
ctgtatatcatcgacgaaccattccttatctccgattcaggattgtcacttcttatgtagccataagtcgtttgacccgaagaagggtcatcccaattct |
23358337 |
T |
|
| Q |
203 |
tccaagctgttagttgcctattaagaccgctcgtaaggttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23358336 |
tccaagctgttagttgcctattaagaccgctcgtaaggttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
23358237 |
T |
|
| Q |
303 |
gtaaaaaccatgatcactatggtctttct |
331 |
Q |
| |
|
|||||| |||||||||||||||||||||| |
|
|
| T |
23358236 |
gtaaaagccatgatcactatggtctttct |
23358208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 302
Target Start/End: Original strand, 23343525 - 23343587
Alignment:
| Q |
240 |
gttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
302 |
Q |
| |
|
|||||| ||||||||||||||||| | || ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23343525 |
gttccatccaagcttcattcctggcaaaaatgtatcacttggatagtcaaaactctgccacaa |
23343587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 302
Target Start/End: Complemental strand, 23383718 - 23383656
Alignment:
| Q |
240 |
gttccaaccaagcttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaa |
302 |
Q |
| |
|
|||||| ||||||||||||||||| | || ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
23383718 |
gttccatccaagcttcattcctggcaaaaatgtatcacttggatagtcaaaactctgccacaa |
23383656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 252 - 305
Target Start/End: Complemental strand, 31705291 - 31705238
Alignment:
| Q |
252 |
cttcattcctggaagaattgtatcactaggatagtcaaagctctgccacaagta |
305 |
Q |
| |
|
|||||| ||||| | ||||||||||| |||||||||||||| ||||||||||| |
|
|
| T |
31705291 |
cttcatccctggcaaaattgtatcacagggatagtcaaagctttgccacaagta |
31705238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University