View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_158 (Length: 334)
Name: NF11737A_low_158
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_158 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 13 - 319
Target Start/End: Original strand, 46593816 - 46594122
Alignment:
| Q |
13 |
atggacatcaaaatctacctgcatttgttctgatggaataccttctctaggaggcaaactggttaagacaggttttgctggtaaatttcctgacaagtgt |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46593816 |
atgggcatcaaaatctacctgcatttgttctgatggaataccttctctaggaggcaaactggttaagacaggttttgctggtaaatttcctgacaagtgt |
46593915 |
T |
|
| Q |
113 |
gcagattttccaggagcagaatgcttctccggttggtccgacgtccgctgtaagtttagannnnnnnnnnnnnnnnnctctctctcctcaataacagaag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
46593916 |
gcagattttccaggagcagaatgcttctccggttggtccgacgtccgctgtaagtttagattttttttcttttttttctttctctcctcaataacagaag |
46594015 |
T |
|
| Q |
213 |
agtccaagtcagctgcaggtcgcttgtgaccttttatcttcttctctacactaattttgtgatgctttgcttcaactggtaaactgatttcgcccttaac |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46594016 |
agtccaagtcagctgcaggtcgcttgtgaccttttatcttcttctctacactaattttgtgatgctttgcttcaactggtaaactaatttcgcccttaac |
46594115 |
T |
|
| Q |
313 |
ttgatgt |
319 |
Q |
| |
|
||||||| |
|
|
| T |
46594116 |
ttgatgt |
46594122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University