View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_196 (Length: 306)
Name: NF11737A_low_196
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_196 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 5 - 215
Target Start/End: Complemental strand, 20780800 - 20780590
Alignment:
| Q |
5 |
gagcacattaacaggcttttgtatgcatttgttttgtttgacatcattcattcttacgggtttcagtgaatattgaaacaatcgggagtacacgagtttg |
104 |
Q |
| |
|
|||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||| | |
|
|
| T |
20780800 |
gagcccatcaacaggcttttgtatgcatttgttttgtttgacatcattcattcttacgggtttcagtgaatattgaatcaatcgggagtacatgagttcg |
20780701 |
T |
|
| Q |
105 |
aaccctgggtgaagcaatctttaaccaagtttcacttacctttcagccgaacttccgattatcagattcctcaaggttgttgatattactctatgactat |
204 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
20780700 |
aaccctgggtaaagcaatctttaaccaagtttcacttacctttcagccgaacttccgattatcagattcctcaaggttgttaatattactctatgactat |
20780601 |
T |
|
| Q |
205 |
gctcaatgttt |
215 |
Q |
| |
|
||||||||||| |
|
|
| T |
20780600 |
gctcaatgttt |
20780590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 210 - 288
Target Start/End: Complemental strand, 20780557 - 20780479
Alignment:
| Q |
210 |
atgtttccctttcattgtaacaatttcaattctcgttgagataactttattgcaattgctggaactggtaatgttataa |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20780557 |
atgtttccctttcattgtaacaatttcaattctcgttgagataactttattgcaattgctggaactggtaatgttataa |
20780479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University