View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_201 (Length: 302)
Name: NF11737A_low_201
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_201 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 12 - 107
Target Start/End: Original strand, 9303423 - 9303518
Alignment:
| Q |
12 |
tgttattgctttgtgtggttggttgactggttttggtgatgttgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttacg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303423 |
tgttattgctttgtgtggttggttgactggttttggtggtgatgttcgtgatggtgatttttgatgttatgtggtcttggttttgatttggttacg |
9303518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 220 - 302
Target Start/End: Original strand, 9303619 - 9303702
Alignment:
| Q |
220 |
attactggtttatgatggtatcagacaaggtttggaattagg-ttgatgcaaaatttggcagctttccttgtgttttttcttga |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9303619 |
attactggtttatgatggtatcagacaaggtttggaattagggttgatgcaaaatttggcagctttccttgtgttttttcttga |
9303702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University