View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_202 (Length: 302)
Name: NF11737A_low_202
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_202 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 7 - 291
Target Start/End: Complemental strand, 49086584 - 49086300
Alignment:
| Q |
7 |
agaagggacaatggaatgaaggagacgtggcttagatcgagtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcattc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
49086584 |
agaagggacaatggaatgaaggagacgtggcttagatcgggtcgtttcaccgacatttggataaacttatagacttataaaaccaacagtttctgcatgc |
49086485 |
T |
|
| Q |
107 |
aatgaaagttggtttgctcactattgattatgtgtgtttagtatagttctacacatgtttggttctcatgcttcgacagatcccacaacacgtcacattc |
206 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49086484 |
aatgaaaattggtttgctcactattgattatgtgtgtttagtatagttctacacatgtttggttctcatgcttcgccagatcccacaacacgtcacattc |
49086385 |
T |
|
| Q |
207 |
agtttttacaccatttatttatttgcaaagagagcaaaattgttcatacttcaaatggaatttaggagcaagcaaacaccttcat |
291 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49086384 |
aatttttacaccatttatttatttgcaaagagagcaaaattgttcatacttcaaatggaatttaggagcaagcaaacaccttcat |
49086300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University