View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_225 (Length: 291)

Name: NF11737A_low_225
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_225
NF11737A_low_225
[»] chr2 (2 HSPs)
chr2 (100-291)||(41686472-41686663)
chr2 (100-291)||(18317240-18317417)
[»] chr1 (4 HSPs)
chr1 (100-188)||(7149629-7149717)
chr1 (226-291)||(49210095-49210160)
chr1 (226-291)||(49665398-49665463)
chr1 (226-291)||(49708955-49709020)
[»] chr4 (1 HSPs)
chr4 (107-188)||(8476797-8476878)


Alignment Details
Target: chr2 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 100 - 291
Target Start/End: Complemental strand, 41686663 - 41686472
Alignment:
100 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttccccctgtcctttctgccccaccgccgccgccaacacccatcctcata 199  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||| |||||||||||||| |||||||||    
41686663 tcagcaaaattctgtctttgaccctctcttgtctcttccgtctcccttccttcaacctgtcctttctgccccaccaccgccgccaacacctatcctcata 41686564  T
200 cccatcattcctccatttagttgtggtatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 291  Q
    |||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41686563 cccatcattccttcatttagttgtggtatcatatttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 41686472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 100 - 291
Target Start/End: Original strand, 18317240 - 18317417
Alignment:
100 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttccccctgtcctttctgccccaccgccgccgccaacacccatcctcata 199  Q
    ||||| ||||||||||||||||||||||  ||||||||||||||||||||||| || |||||||||   |||||| |||| |||||||||||||||        
18317240 tcagcgaaattttgtctttgaccctctc--gtctcttccgtctcccttccttcaccatgtcctttccatcccaccaccgctgccaacacccatcct---- 18317333  T
200 cccatcattcctccatttagttgtggtatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 291  Q
            |||| |||||||||||||||||| |||||||||||| || |||||||| ||||||||||| |||||||||||||||||||||||    
18317334 --------tccttcatttagttgtggtatcagctttcctttcaccaccacagaactccaggattgtgacttattgccaatacctaactgtga 18317417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 5e-19; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 100 - 188
Target Start/End: Original strand, 7149629 - 7149717
Alignment:
100 tcagcaaaattttgtctttgaccctctcttgtctcttccgtctcccttccttccccctgtcctttctgccccaccgccgccgccaacac 188  Q
    |||||||||||||||||||| ||||||||||||||||  |||||||||||||  || |||||||||  ||||||| |||| ||||||||    
7149629 tcagcaaaattttgtctttggccctctcttgtctcttgtgtctcccttcctttaccttgtcctttccaccccaccaccgctgccaacac 7149717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 291
Target Start/End: Original strand, 49210095 - 49210160
Alignment:
226 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 291  Q
    ||||| ||||||||||||||| |||||||  ||||| ||||  ||||||||||||||| |||||||    
49210095 tatcagctttcctttcactaccacagaacgccaggactgtggcttattgccaatacctgactgtga 49210160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 291
Target Start/End: Original strand, 49665398 - 49665463
Alignment:
226 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 291  Q
    ||||| ||| ||||||||||| |||||||  ||||| ||||  |||||||||||||||||||||||    
49665398 tatcagcttccctttcactacaacagaacgccaggactgtggcttattgccaatacctaactgtga 49665463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 226 - 291
Target Start/End: Original strand, 49708955 - 49709020
Alignment:
226 tatcatctttcctttcactactacagaacttcaggattgtgatttattgccaatacctaactgtga 291  Q
    ||||| ||| ||||||||||| |||||||  ||||| ||||  |||||||||||||||||||||||    
49708955 tatcagcttccctttcactacaacagaacgccaggactgtggcttattgccaatacctaactgtga 49709020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 107 - 188
Target Start/End: Complemental strand, 8476878 - 8476797
Alignment:
107 aattttgtctttgaccctctcttgtctcttccgtctcccttccttccccctgtcctttctgccccaccgccgccgccaacac 188  Q
    |||||||| | ||||||||| || ||||||| ||| || ||||||| |||| || |||||| || |||||||||||||||||    
8476878 aattttgtttgtgaccctcttttctctcttctgtcacctttccttcaccctatcttttctgaccgaccgccgccgccaacac 8476797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University