View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_240 (Length: 286)
Name: NF11737A_low_240
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_240 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
| [»] scaffold1377 (1 HSPs) |
| | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 115 - 286
Target Start/End: Original strand, 25614660 - 25614831
Alignment:
| Q |
115 |
gataagtataatggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttacttttagnnnnnnnn |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614660 |
gataagtataatggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttacttttagttttctct |
25614759 |
T |
|
| Q |
215 |
attgtctggaaagttggtattttataccactagaaattatataaattttatttgtgagttatcttggtttaa |
286 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25614760 |
attgtctggaaagttggtattttatactactagaaattatataaattttatttgtgagttgtcttggtttaa |
25614831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 127 - 205
Target Start/End: Original strand, 31262760 - 31262838
Alignment:
| Q |
127 |
ggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttactttta |
205 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
31262760 |
ggtgtttagtatgaatgaattttagggtagactgcaattgtggattgataaaaattctgtttcgatgcttttaccttta |
31262838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1377 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold1377
Description:
Target: scaffold1377; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 204
Target Start/End: Complemental strand, 1169 - 1090
Alignment:
| Q |
125 |
atggtgtttagtatgaatgagttctagggtggactgcaattgtggattgataaaaattctgtttggatgcttttactttt |
204 |
Q |
| |
|
||||| |||||||| ||| ||||||| |||||| ||||||||||||||||| ||||| ||||||||||||||| |||| |
|
|
| T |
1169 |
atggtctttagtattgatgtattctaggatggactacaattgtggattgataacaattcggtttggatgcttttattttt |
1090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University