View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_245 (Length: 285)
Name: NF11737A_low_245
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_245 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 285
Target Start/End: Complemental strand, 16426337 - 16426068
Alignment:
| Q |
16 |
acatcagctgcagtcagtgtcaaagtttccgctttgcataaatcaaccattcccctcttacacaatgtgtgatccaaccttgctataattggttgattga |
115 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16426337 |
acatcagctgcagtcaatgtcaacgtttccgctttgcataaatcaaccattcccctcttacacaatgtgtgatccaaccttgctataattggtttattga |
16426238 |
T |
 |
| Q |
116 |
acttagggtattgaatctcttcatccattcgattgtaaatattcatgaacataagtctgggactgtcataggtaaagaccacccatccaccaatgtcaat |
215 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16426237 |
acctagggtactgaatctcttcatccattcgattgtaaatattcatgaacataagtctgggactgtcataggtaaagaccacccatccaccaatgtcaat |
16426138 |
T |
 |
| Q |
216 |
gccataaaattctttcaatccataccatctattcttaaaaaacaacttcatgttcctcctttccaactga |
285 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16426137 |
gccataaaattcattcaatccataccatccattcttaaaaaacaacttcatgttcctcctttccaactga |
16426068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University