View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_255 (Length: 280)
Name: NF11737A_low_255
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_255 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 5 - 280
Target Start/End: Original strand, 28550887 - 28551162
Alignment:
| Q |
5 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaatcacaaggttcatgccatattaaacacatttcaataaaactgaatta |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550887 |
cacatgcaccgtcccaacaaaaaggaaagtgaagtattattgatgtttaaaaatcacaaggttcatgccatattaaacacatttcaataaaactgaatta |
28550986 |
T |
|
| Q |
105 |
atgtgctagagactctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgttggatcgttcgtagactcattcttgcac |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28550987 |
atgtgctagagaatctatctcatcttcacgccaattgcgaatttcctctaagatcccagatggttgtcttgttggatcgttcgtagactcattcttgcac |
28551086 |
T |
|
| Q |
205 |
ataagacatgatctcttttcgcaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcg |
280 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28551087 |
ataagacatgatctcttttcacaggtgataatcttacacgagatattcatacggttcaatagattacgatgactcg |
28551162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University