View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_267 (Length: 271)
Name: NF11737A_low_267
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_267 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 166
Target Start/End: Complemental strand, 54828207 - 54828042
Alignment:
| Q |
1 |
taggatatatatgttgttcagtggctgtgatggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcatgagttggctcagctgggt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
54828207 |
taggatatataggttgttcagtggctgtgatggtggccaggcaatttttctttgatcttatcaagtatacccttcttctcaagagttggctcagctgggt |
54828108 |
T |
|
| Q |
101 |
gatgggttgcagttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54828107 |
gatgggttgcagttgccgtagggtggtgacctgcacctggaatactggttgcactattatgctcct |
54828042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University