View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_270 (Length: 270)

Name: NF11737A_low_270
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_270
NF11737A_low_270
[»] chr4 (1 HSPs)
chr4 (3-253)||(2619996-2620245)


Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 253
Target Start/End: Original strand, 2619996 - 2620245
Alignment:
3 ggggatgtttacattgcgggtcgcaacataatttggtgagttctgagacatgaaatgcaacaggtccgtgtcttggaacttgacaaattttgttggtgat 102  Q
    ||||||| |||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
2619996 ggggatgcttacattgcgggtcgcaacagaatatggtgaattctgagacatgaaatgcaacaggtccgtgtcttggaacttgccaaattttgttggtgat 2620095  T
103 aatgcaagcttaaccatatgtaaccagctgattttatgtgtttgttttggcgttgggggaatggtgaacgcatgttgagttagaagctatttattgcagc 202  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
2620096 aatgcaagcataaccatatgtaaccagctgattttatgtgtttgttttggcgtttggggaatggtgaacgcatgttgagttagaagctatttattgcagc 2620195  T
203 ttttttatatcacggtgaattgacatgccttcttcgacttggaggttgatg 253  Q
    ||||||||||||||||||||||||||| |||||||||||| ||||||||||    
2620196 ttttttatatcacggtgaattgacatggcttcttcgactt-gaggttgatg 2620245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University