View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_270 (Length: 270)
Name: NF11737A_low_270
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_270 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 3 - 253
Target Start/End: Original strand, 2619996 - 2620245
Alignment:
| Q |
3 |
ggggatgtttacattgcgggtcgcaacataatttggtgagttctgagacatgaaatgcaacaggtccgtgtcttggaacttgacaaattttgttggtgat |
102 |
Q |
| |
|
||||||| |||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2619996 |
ggggatgcttacattgcgggtcgcaacagaatatggtgaattctgagacatgaaatgcaacaggtccgtgtcttggaacttgccaaattttgttggtgat |
2620095 |
T |
|
| Q |
103 |
aatgcaagcttaaccatatgtaaccagctgattttatgtgtttgttttggcgttgggggaatggtgaacgcatgttgagttagaagctatttattgcagc |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2620096 |
aatgcaagcataaccatatgtaaccagctgattttatgtgtttgttttggcgtttggggaatggtgaacgcatgttgagttagaagctatttattgcagc |
2620195 |
T |
|
| Q |
203 |
ttttttatatcacggtgaattgacatgccttcttcgacttggaggttgatg |
253 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
2620196 |
ttttttatatcacggtgaattgacatggcttcttcgactt-gaggttgatg |
2620245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University