View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_282 (Length: 265)
Name: NF11737A_low_282
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_282 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 163 - 248
Target Start/End: Original strand, 46901929 - 46902014
Alignment:
| Q |
163 |
aaataaattcatcaagcaaatcttgaacaatcgctcccatgcagatattattgttctgctgctggaactaaacgcaaccatacctc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
46901929 |
aaataaattcatcaagcaaatcttgaacaatcgctcccatgcagatattattgttcttgtgctggaactaaatgcaaccatacctc |
46902014 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 149
Target Start/End: Original strand, 46901663 - 46901713
Alignment:
| Q |
99 |
tatgttgtgctcttaattgaaaatggttttcacttgtcaattatatctata |
149 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46901663 |
tatgttgtgctcttgattgaaaatggttttcacttgtcaattatatctata |
46901713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University