View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_290 (Length: 263)
Name: NF11737A_low_290
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_290 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 10 - 258
Target Start/End: Complemental strand, 15695203 - 15694955
Alignment:
| Q |
10 |
aatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattacagca |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695203 |
aatatcctttgacttttctaaaatatctatcaatacaaacacatgaagagtggacttggtaaacataaattcatgactcaaattttctatcattacagca |
15695104 |
T |
 |
| Q |
110 |
tcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtactccatggaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15695103 |
tcatttgctttggacttctaaatataatagctcaattatcattacaacatcattggcaataattggaatcatgcaataggaacatagtactccatggaag |
15695004 |
T |
 |
| Q |
210 |
gaagaaaactaaacttgacatcaatattttttgctttcatactatatat |
258 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15695003 |
gaagaaaactaaacttgagatcaatattttttgctttcatactatatat |
15694955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University