View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_306 (Length: 255)
Name: NF11737A_low_306
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_306 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 36 - 230
Target Start/End: Complemental strand, 23377838 - 23377644
Alignment:
| Q |
36 |
tcactacgttccaaatcccaatgattaaacaccacaagacacaaacaaaaagcacttagaagccataatgatcataaccaaaatcaaaacaaacataact |
135 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||| |||||||||||| | ||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23377838 |
tcactacgttccaaattccaatgattatacaccacatgacacaaacaaataacacgtagaagccataatgatcataaccaaaatcaaaacaaacatacct |
23377739 |
T |
|
| Q |
136 |
tgtatacagatggaatcacgacttatcccacacaagtaacaaggaattcgccataaccagaatagttattgtaacactttgatttatgatgtcca |
230 |
Q |
| |
|
|||||||| |||||||||| |||||||||| | |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23377738 |
cgtatacagttggaatcacgtcttatcccaccccagtaacaaggaattcgacataaccagaatagttattgtaacactttgatttatgatgtcca |
23377644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University