View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_307 (Length: 255)
Name: NF11737A_low_307
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_307 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 43669522 - 43669759
Alignment:
| Q |
13 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatacgtgactgttccattaagaaatttaaatggattgatcttaatcgg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669522 |
tgaaagtggcttacaaagacttggttcaaattggtggtttactcattgatgtatatgtgactgttccattaagaaatttaaatggattgatcttaatcgg |
43669621 |
T |
 |
| Q |
113 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcnnnnnnnnnnnnncacattataatgattgcatatttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43669622 |
atacccttaaatgtaccgaccatgttttgcatccaattcattcagatcccaagttgtcttgcaaaaatgaaaaaacacattataatgattgcatatttat |
43669721 |
T |
 |
| Q |
213 |
ggttaagcattgcatgatgatttagtactatcatattt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43669722 |
ggttaagcattgcatgatgatttagtactatcatattt |
43669759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University