View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_312 (Length: 253)
Name: NF11737A_low_312
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_312 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 44546951 - 44547176
Alignment:
| Q |
1 |
gattgatataattaatgtggaaagcttggtaatatgcaatcttatatttgtcaannnnnnnnnnnnctaatagtccacattttatctttcttttatgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44546951 |
gattgatataattaatgtggaaagcttggtaatatgcaatcttaaatttgtcaatttttcttttttctaatagtccacattttatctttcttttatgatg |
44547050 |
T |
|
| Q |
101 |
tgtatgtactatctattcgaatgccattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagtt |
200 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44547051 |
tgtatgtactat----tcgaatgtcattgcttccagtcagcccatcggtaaccgttggatcgagaccaaatggttcagatcttgatcccatctaacagtt |
44547146 |
T |
|
| Q |
201 |
agcgatgcaccgattgtgtgaatgtcggggg |
231 |
Q |
| |
|
|||||||||| ||||||||| |||||||||| |
|
|
| T |
44547147 |
agcgatgcactgattgtgtg-atgtcggggg |
44547176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University