View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_323 (Length: 251)
Name: NF11737A_low_323
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_323 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 43797918 - 43798143
Alignment:
| Q |
17 |
aaatttaaagggacgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgctttcgatggattgggaggttagagtttgtgac |
116 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43797918 |
aaatttaaagggatgtaatcctactagtgtagtgggttggtgcttaattaacaagattcttagtttgcttgcgatggattgggaggttagagtttgtgac |
43798017 |
T |
|
| Q |
117 |
tagtattgtgtagctaattgatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgagttatgtcttgttcaaacta |
216 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43798018 |
tagtattgtgcagctaattaatgtgtttatgctcttgttaatatggggtgcgatagcgaggacgcttgaatactttttgagttatgtcttgttcaaacta |
43798117 |
T |
|
| Q |
217 |
gttggttcgtcattattgatattgtt |
242 |
Q |
| |
|
|||||||||||||||||||| ||||| |
|
|
| T |
43798118 |
gttggttcgtcattattgatgttgtt |
43798143 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University