View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_324 (Length: 251)
Name: NF11737A_low_324
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_324 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 30507744 - 30507985
Alignment:
| Q |
1 |
tcacaatcaaacaagctagaagcttgctttatttctccactagcaaaatctttaatcacctgtcacaacaccaaaagatttagcaaa-nnnnnnnnnctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30507744 |
tcacaatcaaacaagctagaagcttgctttatttctccactagcaaaatctttaatcacctgtcacaacaccaaaagatttagcaaattttttttttctt |
30507843 |
T |
|
| Q |
100 |
tcagaaaatggaattatgcannnnnnncataccctatgctaagcagttatgaaataatg---ttttgnnnnnnngttgcgtcaaggtaaccctgcataca |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||||| |
|
|
| T |
30507844 |
tcagaaaatggaattatgcatttttttcataccctatgctaagcagttatgaaataatgattttttttttttttgttacgtcaaggtaaccctgcataca |
30507943 |
T |
|
| Q |
197 |
actgtggagcccaatccctcaaacaaagtaactgatgtccat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30507944 |
actgtggagcccaatccctcaaacaaagtaactgatatccat |
30507985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University