View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_330 (Length: 250)
Name: NF11737A_low_330
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_330 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 20 - 250
Target Start/End: Original strand, 40477869 - 40478104
Alignment:
| Q |
20 |
atcaatctttatttctattggttgctatattatatattgagtattggaactgcaatgttacctattgattggtgaaactgtg--------ttattattga |
111 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40477869 |
atcaatctttatttctattggtt---atattatatattgagtattggaactgcaatgttacctattgattggtgaaactgtgttattgtgttattattga |
40477965 |
T |
|
| Q |
112 |
tatctcactgttttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaagagcagttggtgaaagtaatgttcaaattaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40477966 |
tatctcactgttttttcatttcctatatgaaaaacaggttgcaaaagaatcttctggcaatcaacaaagagcagttggtgaaagtaatgttcaagttaat |
40478065 |
T |
|
| Q |
212 |
tgttctgactcggatcaaggtggattgaccgaacttgag |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40478066 |
tgttctgactcggatcaaggtggattgaccgaacttgag |
40478104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University