View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_340 (Length: 250)
Name: NF11737A_low_340
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_340 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 244
Target Start/End: Original strand, 49166154 - 49166387
Alignment:
| Q |
11 |
gagatgttattaccgcaattatgcaaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49166154 |
gagatgttattaccgcaattatgcaaagatttattacttacataccaatgcaacagataaaattgaccttttatggtatttattagtcccaaatctagaa |
49166253 |
T |
|
| Q |
111 |
gatagttcataggtttgaatacttttggctacaggttcacaatacctacattttccaaatactagtatgcattatgttgcttgtatattcagtttatttt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49166254 |
gatagttcataggtttgaatacttttggctacaggttcacaatacctacattttccaaatactagtatgcattatgttgcttgtatattcagtttatttt |
49166353 |
T |
|
| Q |
211 |
ctatttagtcttgttacattgttatattcttgga |
244 |
Q |
| |
|
||||||| |||||| |||||||||| |||||||| |
|
|
| T |
49166354 |
ctatttactcttgtgacattgttattttcttgga |
49166387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 12 - 44
Target Start/End: Original strand, 43752585 - 43752617
Alignment:
| Q |
12 |
agatgttattaccgcaattatgcaaagatttat |
44 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
43752585 |
agatgttattgccgcaattatgcaaagatttat |
43752617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University