View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_343 (Length: 249)
Name: NF11737A_low_343
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_343 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 95
Target Start/End: Complemental strand, 31658677 - 31658583
Alignment:
| Q |
1 |
tttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658677 |
tttgaatttgagaatgtttatgaccagttaggattttgatggctatggatatgtttctgtctaagtgtaaatttattttcaaagtttggcattgg |
31658583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 196 - 233
Target Start/End: Complemental strand, 31658558 - 31658521
Alignment:
| Q |
196 |
taatgggagatttatttgatcgtttaacttatgatgtc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31658558 |
taatgggagatttatttgatcgtttaacttatgatgtc |
31658521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University