View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_352 (Length: 249)
Name: NF11737A_low_352
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_352 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 7 - 244
Target Start/End: Original strand, 18260087 - 18260325
Alignment:
| Q |
7 |
tatggtgttagcatctggagttttagggatcaagataagagagtttgcattgtagttgggaaggagcgatccagtcttgaagaattctaccacagcttca |
106 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18260087 |
tatggtgtcagcatatggagttttagggatcaagataagagagtttgcattgtagttgggaaggagccatccagtcttgaagaattctaccacagcttca |
18260186 |
T |
 |
| Q |
107 |
tacacatctttctgaactatatcccaataggtttggaaaaagcaagcaccaaa-ccatgaggccctggtgcaccatcatgattcaaataaaaaatagcat |
205 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260187 |
tacacatctttcttaactatattccaataggtttggaaaaagcaagcaccaaacccatgaggccctggtgcaccatcatgattcaaataaaaaatagcat |
18260286 |
T |
 |
| Q |
206 |
ttttaacttcacttggattaggaatattagtgggaatct |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18260287 |
ttttaacttcacttggattaggaatattagtgggaatct |
18260325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University