View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_353 (Length: 249)
Name: NF11737A_low_353
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_353 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 1414252 - 1414021
Alignment:
| Q |
1 |
taatatataaacaacgacaattttgtcaaaacgtaaatttgacataatgtgtttcatgctgtatttacggatcatgctagaatgctttgggacaccatgc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414252 |
taatatataaacaatgacaattttgtcaaaacgtaaatttgacataatgtgtttcatgctgtatttacggatcatgctagaatgctttgggacaccatgc |
1414153 |
T |
|
| Q |
101 |
ttttggatcaaacacttgtgagnnnnnnntgcctaacaatagctttgagacacgtgttggataaaaagacagagagatgggattgacacaaacattagac |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414152 |
ttttggatcaaacacttgtgagaaaaaaatgcctaacaatagctttgagacacgtgttggataaaaagacagagagatgggattgacacaaacattagac |
1414053 |
T |
|
| Q |
201 |
aatggtaatcttttttacggtactaatgatgt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1414052 |
aatggtaatcttttttacggtactaatgatgt |
1414021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University