View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_358 (Length: 248)
Name: NF11737A_low_358
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_358 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 9868070 - 9867824
Alignment:
| Q |
1 |
acatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctctttgatcatgatttcgtc |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9868070 |
acatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctctttgatcatgatttcgcc |
9867971 |
T |
|
| Q |
101 |
atgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagacagtgtgatccaattaccac |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9867970 |
atgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatggtgtgatccaattaccac |
9867871 |
T |
|
| Q |
201 |
taagatcgctactaaaggcaaaccccaagcgactagtcttttgcgaa |
247 |
Q |
| |
|
|| ||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
9867870 |
tacgatcgctactaaaggcaaaccacagtcgactagtcttttgcgaa |
9867824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University