View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_366 (Length: 248)
Name: NF11737A_low_366
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_366 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 248
Target Start/End: Original strand, 18269935 - 18270167
Alignment:
| Q |
16 |
ggacatcaacctaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgaatcatggtggctagaagcgataaaagtag |
115 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18269935 |
ggacatcaaccgaatgataacaagcccaattttctgcaatatgaagacactgttgaagacaactacagtgattcatggtggctagaagcgataaaagtag |
18270034 |
T |
 |
| Q |
116 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggact |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18270035 |
ttgaggaagtggagaataagaaaactgcaacagagctatgcagcaaggttagtctgtcttaatttagctttcccttgttatcttgtttaacaataggact |
18270134 |
T |
 |
| Q |
216 |
gaagccctatcccctttatttagacggcatagg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
18270135 |
gaagccctatcccctttatttagacggcatagg |
18270167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University