View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_376 (Length: 247)
Name: NF11737A_low_376
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_376 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 33846418 - 33846212
Alignment:
| Q |
16 |
catcacatgcaagttgagataaaatttcctcttttctattgcaattgctcacatttgtgagctcttaacttgttcttgcaattgcatcatctttaattta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33846418 |
catcacatgcaagttgagataaaatttcctcttttctattgcaattgctcacatttgtgagctcttaacttgttcttgcaattgcatcatctttaattta |
33846319 |
T |
 |
| Q |
116 |
agtgatcacaaaattaatattttataaactcttgtcagaccttttcttaaagaggcaatgttaatatgttaattgttaacttgtcggtattttgttcttg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33846318 |
agtgatcacaaaattaatattttataaactcttgtcagaccttttcttaaagaggcaatgttaatatgttaattgttaacttgtccgtattttgttcttg |
33846219 |
T |
 |
| Q |
216 |
gaggtga |
222 |
Q |
| |
|
||||||| |
|
|
| T |
33846218 |
gaggtga |
33846212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University