View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_393 (Length: 245)
Name: NF11737A_low_393
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_393 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 19171374 - 19171141
Alignment:
| Q |
1 |
gaggagagaaccttcgtagaaaattgacatggttgttgatgagtagttaattggggctatgtttggattggtgacatggacagttagaagaacttctgcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
19171374 |
gaggagagaaccttcgtagaaaattgacatggttgttgatgagtagttaattggagctatgtttggattggtgacatggacggttaaaagaacttctgcg |
19171275 |
T |
|
| Q |
101 |
tctacaacggggaggcttggttttaaggaggtgaagttgatggagatgagatggaatgttgggtcttttggttttgctgagagaattgatgttgctgcta |
200 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19171274 |
tctacgacggggaggcttggttttaaggaagtgaagttgatggagatgagatgaaatgttgggtcttttggttttgctgagagaattgatgttgctgcta |
19171175 |
T |
|
| Q |
201 |
ctgctgatgctgctcctattattgctgatgtcca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
19171174 |
ctgctgatgctgctcctattattgctgatgtcca |
19171141 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University