View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_404 (Length: 244)
Name: NF11737A_low_404
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_404 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 17 - 244
Target Start/End: Original strand, 47884891 - 47885118
Alignment:
| Q |
17 |
atcaccaatgaagagttacccttatcaacaacgaatgtctgacaaattaccttttcaaaggtaacaatttccacattgtacaaaccactgaatcccctga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47884891 |
atcaccaatgaagagttacccttatcaacaacgaatgtctgacaaattaccttttcaaaggtaacaatttccacattgtacaaaccactgaatcccctga |
47884990 |
T |
|
| Q |
117 |
agttgaattccccttgctcatcaagatgaccatgagtgtgagataaccactcttctttaagatcaatgaatcttctcccagcttcattgatttcaccttc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47884991 |
agttgaattccccttgctcatcaagatgaccatgagtgtgagataaccactcttctttaagatcaatgaatcttctcccagcttcattgatttcaccttc |
47885090 |
T |
|
| Q |
217 |
tgcattcaccaaatgtgcattgtcgcgg |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
47885091 |
tgcattcaccaaatgtgcattgtcgcgg |
47885118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 107 - 237
Target Start/End: Complemental strand, 4624108 - 4623978
Alignment:
| Q |
107 |
aatcccctgaagttgaattccccttgctcatcaagatgaccatgagtgtgagataaccactcttctttaagatcaatgaatcttctcccagcttcattga |
206 |
Q |
| |
|
||||| || |||||||||| ||||| |||| || |||||||||| | ||||||| |||||||| ||| | | | | || ||| | ||||||||||| | |
|
|
| T |
4624108 |
aatcctctaaagttgaattgaccttgttcattaacatgaccatgactatgagatagccactcttgtttcaaagctagaaacctttttccagcttcattaa |
4624009 |
T |
|
| Q |
207 |
tttcaccttctgcattcaccaaatgtgcatt |
237 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
4624008 |
tatcaccttctgcattcaccaaatgtgcatt |
4623978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University