View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_410 (Length: 243)
Name: NF11737A_low_410
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_410 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 10 - 195
Target Start/End: Complemental strand, 33262239 - 33262054
Alignment:
| Q |
10 |
tgaatgacccaaaatcattgagctcagctcttctgaagttgtgatgttgaaaggcagacttgctggcccttgcaatgtggcattctgcggttgcaaacta |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33262239 |
tgaatgacccaaaatcattgagctcagctcttctgaaattgggatgttgaaaggcagacttgttggcccttgcagtgtggcattctgcggttgcaaacta |
33262140 |
T |
|
| Q |
110 |
gtcattgttgacccctccaatatggcagtttgtggttgcagatgactaattgctggcccttccaacatggcactctgtggttgcaa |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||| |||||||| ||||||||||||||||||| |||||||| |||| |
|
|
| T |
33262139 |
gtcattgttgacccctccaatatggcagttcgtggttgcagattactaattgatggcccttccaacatggcagtctgtggtagcaa |
33262054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 179 - 230
Target Start/End: Complemental strand, 33262025 - 33261974
Alignment:
| Q |
179 |
gcactctgtggttgcaactcagtcatcgctggcccttgcaatatcgctctct |
230 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33262025 |
gcactctgtggttccaactcagtcatcgctggcccttgcaatatcgctctct |
33261974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University