View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_412 (Length: 243)
Name: NF11737A_low_412
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_412 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 12 - 223
Target Start/End: Complemental strand, 34365628 - 34365417
Alignment:
| Q |
12 |
aaaataaaaatagaaattattnnnnnnngaagtttgagatagtggtgtatactttatctattggccatgcactataaatataatttcttctcgagtctta |
111 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34365628 |
aaaataaaaatagaaattattaaaaaaagaagtttgagatagtggtgtatactttatctattggccatgcactataaatataatttcttttcgagtctta |
34365529 |
T |
|
| Q |
112 |
cctaatcacactagctagtcaataatcaatgtgttttgaattaattatagtaaaactgattaaataaatgtttgattgcatgaaagtcgacacgtaagaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
34365528 |
cctaatcacactagctagtcaataatcaatgtggtttgaattaattatagtaaaactgattaaataaatgtctgattgcatgaaagttgacacgtaagaa |
34365429 |
T |
|
| Q |
212 |
atttcaccttgg |
223 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34365428 |
atttcaccttgg |
34365417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University