View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_413 (Length: 242)
Name: NF11737A_low_413
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_413 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 19173190 - 19172966
Alignment:
| Q |
1 |
aaaacaactaatggaggttaagggcttacctgacataagggagaaatagtcaaagaaaaatggttagattactc-attattcagtaaacaaacactacct |
99 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
19173190 |
aaaacaactaatggaggttaaggacttccctgacataagggagaaattgtcaaagaaaaatggttagattactccattattcagtaaacaaacactacct |
19173091 |
T |
|
| Q |
100 |
tcagcacatcacatcgtctgcagtggtctctaatattctaacatgaaacatttttaacaaataatcccatgattactcataattacttttcagtcttctg |
199 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
19173090 |
tcagcacatcacatcatctgcagaggtctctaatattctaacatgaaacatttataacaaataatcccatgattactcataattacttttcaatcttctg |
19172991 |
T |
|
| Q |
200 |
ctgctactcataaaccatagggatg |
224 |
Q |
| |
|
|| ||||||||||| ||||| |||| |
|
|
| T |
19172990 |
cttctactcataaatcatagtgatg |
19172966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University