View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_419 (Length: 242)
Name: NF11737A_low_419
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_419 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 28216965 - 28216734
Alignment:
| Q |
1 |
aaaatgtgcaagaatcgtctttttcatttctttgatccttgtgtatttttattaannnnnnnataggggcactgtctcataattcgcccaagacatctaa |
100 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| || |
|
|
| T |
28216965 |
aaaatgtgcaataatcgtctctttcttttctttcatccttgtgtatttttattaatttttttataggggcactgtctcatgattcgcccaagacatccaa |
28216866 |
T |
 |
| Q |
101 |
atttaaaggtccggccctagctacatcggtaacgatccttccctttgccgcttgagaagaaatatgagcattattgaatcgaacacgatttctagctatc |
200 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28216865 |
atttaaaggaccggccctagctacattggtaacgatccttccctttgccgcttgagaagaaatatgagcattattgaatcgaacacgatttctagctatc |
28216766 |
T |
 |
| Q |
201 |
caaatagtgtgaataat-ctaacaatgatgat |
231 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |
|
|
| T |
28216765 |
caaatagtgtgaataatactaacaatgatgat |
28216734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University