View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_42 (Length: 440)
Name: NF11737A_low_42
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_42 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 16 - 265
Target Start/End: Complemental strand, 9868070 - 9867821
Alignment:
| Q |
16 |
acatcaaaccctatccttaattcaacatacaaaaattgctttggaacattggtgaaatataaagaagcgacgccagtctctctttgatcatgatttcgtc |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |
|
|
| T |
9868070 |
acatcaaaccctttccttaattcaacatacaaaaattgctttggaacattggtgaaatataaggaagcgacgccagtctctctttgatcatgatttcgcc |
9867971 |
T |
 |
| Q |
116 |
atgcatcgtgaatatgatgattgagtcatatttgtttagccatgcatgactaaattccacgtgaataaaacttttctagacagtgtgatccaattaccac |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9867970 |
atgcatcgtgaatatgatgattgaatcatatttgtttagccatgcatgactaaattccacgttaataaaacttttctagatggtgtgatccaattaccac |
9867871 |
T |
 |
| Q |
216 |
taagatcgctactaaaggcaaaccacaatcgactagtcttttgcgaatgt |
265 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9867870 |
tacgatcgctactaaaggcaaaccacagtcgactagtcttttgcgaatgt |
9867821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 262 - 362
Target Start/End: Complemental strand, 9867765 - 9867665
Alignment:
| Q |
262 |
atgttgaagtcttcaaccctttgattactgttgattnnnnnnnttgccgcgagaaactctgaaacttggcatgtcgtcgatcatcctcccatgacccata |
361 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9867765 |
atgttgaagtcttcaaccctttgatgactattgattctcccccttgccgcgagaaactctgaaacttggcatgtcctcgatcatcctcccatgacccata |
9867666 |
T |
 |
| Q |
362 |
t |
362 |
Q |
| |
|
| |
|
|
| T |
9867665 |
t |
9867665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 395 - 424
Target Start/End: Complemental strand, 9867635 - 9867606
Alignment:
| Q |
395 |
ttagtggaacccttccgctcccatgatgtc |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9867635 |
ttagtggaacccttccgctcccatgatgtc |
9867606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University