View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_420 (Length: 242)
Name: NF11737A_low_420
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_420 |
 | |
|
| [»] scaffold0212 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0212 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: scaffold0212
Description:
Target: scaffold0212; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 12264 - 12497
Alignment:
| Q |
1 |
aatggaaacttgtataggcccctatggctctcctaaaacccttcataagggatatggctataatgagaatatcttgctttccgcacccgctagtgcacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12264 |
aatggaaacttgtataggcccctatggctctcctaaaacccttcataagggatatggctataatgagaatatcttgctttccgcacccgctagtgcacat |
12363 |
T |
|
| Q |
101 |
acactttcgtttacttgggctcgtgaggtggtgggaaatggcctgatctatgcttatgctcttgtctaaggagtccgcagactcttattagactgcttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12364 |
acactttcgtttacttgggctcgtgaggtggtgggaaatggcctgatctatgcttatgctcttgtctaaggagtccgcagactcttattagactgcttgt |
12463 |
T |
|
| Q |
201 |
gcctatgtctcgcgaaatccatgatgtccatctc |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
12464 |
gcctatgtctcgcgaaatccatgatgttcatctc |
12497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 179 - 227
Target Start/End: Original strand, 21805420 - 21805468
Alignment:
| Q |
179 |
agactcttattagactgcttgtgcctatgtctcgcgaaatccatgatgt |
227 |
Q |
| |
|
|||||||||||||| || |||||||||||||| ||||||||||| |||| |
|
|
| T |
21805420 |
agactcttattagaatgtttgtgcctatgtcttgcgaaatccataatgt |
21805468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University