View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_423 (Length: 242)
Name: NF11737A_low_423
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_423 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 15827557 - 15827796
Alignment:
| Q |
1 |
agtggaatttcttatgatataacctacattttgtattttgatggacatgaaannnnnnncattgtgacctattgtattctcaaccccatagaaatcgtaa |
100 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15827557 |
agtggaatttctcatgatataaccaacattttgtattttgatggacatgaaatttgtttcattgtgacctattgtattctcaaccccatagaaatcgtaa |
15827656 |
T |
|
| Q |
101 |
taaaatttgtggctaaaaaggtcttgctttcaaatagttaaaatagcaatccataactaggagtga-nnnnnnnnncaactaacaactaagttataatga |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15827657 |
taaaatttgtggctgaaaaggtcttgctttcaaatagttaaaatagcaatccataactaggagtgatttttttttccaactaacaactaagttataatga |
15827756 |
T |
|
| Q |
200 |
aaacagcaaacaaaacacaatataaacagaacaccaaact |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15827757 |
aaacagcaaacaaaacacaatataaacagaacacaaaact |
15827796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University