View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_426 (Length: 242)
Name: NF11737A_low_426
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_426 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 145 - 232
Target Start/End: Original strand, 43511794 - 43511881
Alignment:
| Q |
145 |
ctttgcaacatgaaggctgagcgatcattcgatcgtagtttgtgggctcatattaactatgaagccttattatgtgtccaactgctcg |
232 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43511794 |
ctttacaacatgaaggctgagcgatcattcgatcgtagtttgtgggctcatattaactatgaagccttattatgtgttcaactgctcg |
43511881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 64 - 145
Target Start/End: Original strand, 43511101 - 43511182
Alignment:
| Q |
64 |
ttaatcttaggtttgatagaaccataatctcaatatggagcggatcaatgtaagaagttgctcggctgtatctgcaaaagac |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43511101 |
ttaatcttaggtttgatagaaccataatctcaatatggagctgatcaatgtaagaagttgctcggctatatctgcaaaagac |
43511182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 44
Target Start/End: Original strand, 43511031 - 43511064
Alignment:
| Q |
11 |
catcacctcagactcttactatactcaccaagcc |
44 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43511031 |
catcacctcagactcttactatactcaccaagcc |
43511064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University