View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_432 (Length: 241)
Name: NF11737A_low_432
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_432 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 21 - 189
Target Start/End: Original strand, 18057692 - 18057860
Alignment:
| Q |
21 |
gggtgttttggtctgcagatttttctgttttgtcttgcctatattgtttggcggtgcggttcatgttgggtttttgcggtagtggagctttgtttcggca |
120 |
Q |
| |
|
|||||||||| || || ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18057692 |
gggtgttttgatcaacaaattttaatgttttgccttgcctatattgtttggcggtgcggttcatgttgggtttttgcggtagtggagctttgtttcggca |
18057791 |
T |
 |
| Q |
121 |
aaagggtgtgagacaggggattgcgtgttttctttcgcatgtatatgtcggtatcaatacctgagtccc |
189 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18057792 |
aaagggtgtgagacaggggtttgcgtgttttctttcgcatgtatatgtcggcatcaatacctgagtccc |
18057860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University