View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_433 (Length: 241)
Name: NF11737A_low_433
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_433 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 7 - 229
Target Start/End: Original strand, 32033129 - 32033359
Alignment:
| Q |
7 |
aactaaggtccctttcacgattcatctcttaattaagcttattaacaacttgacaaacatttgcttgggttggattattgttgctttaaataaagcaagc |
106 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32033129 |
aactaaggtccctttcacaattcatcttttaactaagcttattaacaacttgacaaacaattgcttgggatggattattgttgctttaaataaagcaagc |
32033228 |
T |
|
| Q |
107 |
attggaatgaaaaatacgaaaaccatctcctttcatttcctttttacgttttgggattccttcgtgtgattatgg-------taattattg-ttttgtta |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||| |
|
|
| T |
32033229 |
attggaatgaaaaatacgaaaaccatctcatttcatttcctttttacgttttgggattctttcgtgtgattatggtcaatattaattattgtttttgtta |
32033328 |
T |
|
| Q |
199 |
aacgttttgtcttttgccttccaagcactaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32033329 |
aacgttttgtcttttgccttccaagcactaa |
32033359 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University