View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_440 (Length: 240)
Name: NF11737A_low_440
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_440 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 145 - 186
Target Start/End: Original strand, 31133807 - 31133848
Alignment:
| Q |
145 |
gagattacattctccaatccacaatttacttacgagttacat |
186 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
31133807 |
gagattacattctccaatccactatttacttatgagttacat |
31133848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University