View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_445 (Length: 239)
Name: NF11737A_low_445
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_445 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 410160 - 410360
Alignment:
| Q |
21 |
agaagcaagtatgtgggagtatctatggttgggaaaacattagcaataatgggatttggaaaagttggatctgaagttgcaaggcgtgcaaaaggattag |
120 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
410160 |
agaagcaagtatgttggagtatctatggttgggaaaacattagcaataatggggtttggaaaagttggatctgaagttgcaaggcgtgcaaaaggattag |
410259 |
T |
 |
| Q |
121 |
gaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtctcatttgatcaagcaatcacaaccgctga |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
410260 |
gaatgaatgtgattgctcatgacccttatgctccagctgatagagcacgtgctgttggtgtggaattagtttcatttgatcaagcaatcacaaccgctga |
410359 |
T |
 |
| Q |
221 |
t |
221 |
Q |
| |
|
| |
|
|
| T |
410360 |
t |
410360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 21 - 161
Target Start/End: Original strand, 48785408 - 48785548
Alignment:
| Q |
21 |
agaagcaagtatgtgggagtatctatggttgggaaaacattagcaataatgggatttggaaaagttggatctgaagttgcaaggcgtgcaaaaggattag |
120 |
Q |
| |
|
||||| |||||||| ||||| || | |||||||| ||| | || ||||||||||||| || |||||| |||| ||||| |||||||| || || | | |
|
|
| T |
48785408 |
agaagtaagtatgttggagtttccctagttgggaagacacttgctgtaatgggatttgggaaggttggaactgaggttgctaggcgtgctaaggggcttg |
48785507 |
T |
 |
| Q |
121 |
gaatgaatgtgattgctcatgacccttatgctccagctgat |
161 |
Q |
| |
|
| ||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
48785508 |
gtatgaaggttattgctcatgatccttatgctcctgctgat |
48785548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University