View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_449 (Length: 238)
Name: NF11737A_low_449
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_449 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 21 - 226
Target Start/End: Complemental strand, 39578753 - 39578548
Alignment:
| Q |
21 |
aaaatcaagggacaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttcgccccttagttaatgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39578753 |
aaaatcaagggacaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttccccccttagttaatgg |
39578654 |
T |
 |
| Q |
121 |
ttgttggtctgttctcaattgtaagattaataatggagtaaaacagtattcattttcaagtgattatatgaagatctatgtatggtagaatgttgtgata |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39578653 |
ttgttggtctgttctcaattgtaagattaataatggagtaaaacagtattcattttcaagtgattatatgaagatctatgtatggtagaatgttgtgatt |
39578554 |
T |
 |
| Q |
221 |
ttcttc |
226 |
Q |
| |
|
|||||| |
|
|
| T |
39578553 |
ttcttc |
39578548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 22 - 104
Target Start/End: Complemental strand, 39542384 - 39542302
Alignment:
| Q |
22 |
aaatcaagggacaacaatcaacacgcaagtgtctccatgaactgttttgtagatagctcacttctctgttttgtccctgtttc |
104 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| ||||||| | ||| |||| ||||||||||||||| |||||| |
|
|
| T |
39542384 |
aaatcaaggtacaacaatcaacacgcaagtgtctccatgagctgttttttcaatacctcatttctctgttttgtccttgtttc |
39542302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 58
Target Start/End: Complemental strand, 39574219 - 39574183
Alignment:
| Q |
22 |
aaatcaagggacaacaatcaacacgcaagtgtctcca |
58 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
39574219 |
aaatcaaggcacaacaatcaacacgcaaatgtctcca |
39574183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University