View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_453 (Length: 238)
Name: NF11737A_low_453
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_453 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 226
Target Start/End: Complemental strand, 11565696 - 11565490
Alignment:
| Q |
20 |
atggtgcatagacatgaacgacggaaatggcgcagattgtggtgagttatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaag |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11565696 |
atggtgcatagacatgaacgacggaaatggcgcagattgtggtgagtaatggggaacagaggattaactgcgttgtggtagttcgggttcgtcgaagaag |
11565597 |
T |
 |
| Q |
120 |
ttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcatat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11565596 |
ttgtgtttcacgtgaatggatagataataggtattgataactgattgagtaaagaagaaacaagtgtttaattccaacaatttgtagtgcacttgcattt |
11565497 |
T |
 |
| Q |
220 |
tattcga |
226 |
Q |
| |
|
|||||| |
|
|
| T |
11565496 |
cattcga |
11565490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University