View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_454 (Length: 237)
Name: NF11737A_low_454
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_454 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 24 - 219
Target Start/End: Original strand, 38483684 - 38483881
Alignment:
| Q |
24 |
tatttttggagtaagaggtgttttgagaaattgaa-tggcctattgatatcgggagtagttttttcgatggaaatcgtgttgggaagacaggttttgttg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38483684 |
tatttttggagtaagaggtgttttgagaaattgaaatggcctattgatattgggagtagttttttcgatggaaatcgtgttgggaagacgggttttgttg |
38483783 |
T |
 |
| Q |
123 |
aacggaggtcgttttggaatttg-ttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
219 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483784 |
aacggaggtcgttttggaatttgtttaggagttttgataggctttgggtgatgttgattttgtttcttcaagtggcgattattgttggttggaatgat |
38483881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 100 - 193
Target Start/End: Original strand, 30118163 - 30118257
Alignment:
| Q |
100 |
tgttgggaagacaggttttgttgaacggaggtcgttttggaatttgtta-ggagttttgataggctttgggtgatgttgattttgtttcttcaag |
193 |
Q |
| |
|
|||||| ||||| || |||||||| | ||| |||||||||||| |||| |||||||||| ||||||||| | |||||| | ||||||||||||| |
|
|
| T |
30118163 |
tgttggtaagaccggatttgttgagcagagatcgttttggaatctgtttcggagttttgacaggctttggattatgttggtgttgtttcttcaag |
30118257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University