View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_459 (Length: 237)
Name: NF11737A_low_459
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_459 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 109 - 237
Target Start/End: Complemental strand, 4843667 - 4843539
Alignment:
| Q |
109 |
gaaactatgttagaattgttgttcaataattcaaattttgcagcagagagttgcagaaaacatctattgtcaaacactataagcagaaaattataccatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4843667 |
gaaactatgttagaattgttgttcaataattcaaattttgcagcagagagttgcagaaaacatctattgtcaaacactataagcagaaaattataccatg |
4843568 |
T |
|
| Q |
209 |
aaagtattttgtagcatatctagtggcgg |
237 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4843567 |
aaagtattttgtagcatatctagtggcgg |
4843539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 14 - 56
Target Start/End: Complemental strand, 4844284 - 4844242
Alignment:
| Q |
14 |
gacatcaagaagagcatataatgagataaaatttggatttgaa |
56 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4844284 |
gacaccaagaagagcatataatgagataaaatttggatttgaa |
4844242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 22 - 50
Target Start/End: Complemental strand, 4709802 - 4709774
Alignment:
| Q |
22 |
gaagagcatataatgagataaaatttgga |
50 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4709802 |
gaagagcatataatgagataaaatttgga |
4709774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University