View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_462 (Length: 236)
Name: NF11737A_low_462
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_462 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 6 - 236
Target Start/End: Original strand, 46294503 - 46294733
Alignment:
| Q |
6 |
atgagatggacatcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggctta |
105 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294503 |
atgacatggccatcaaattggagtgtctcacctttctttgtatagatattttagttcacacatacaattcagatacttgcatccttgctatttgggctta |
46294602 |
T |
|
| Q |
106 |
gagatttgatttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46294603 |
gagatttgatttgcataatggtttttgtgtaggtgggagtgaatattttgatggctcaagttggttgctttgttccatgtgacaaagcgagcatatctgt |
46294702 |
T |
|
| Q |
206 |
tcgtgattgcatttttgctcgtgttggtgca |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46294703 |
tcgtgattgcatttttgctcgtgttggtgca |
46294733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University