View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11737A_low_474 (Length: 233)

Name: NF11737A_low_474
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11737A_low_474
NF11737A_low_474
[»] chr8 (1 HSPs)
chr8 (142-226)||(34583074-34583158)


Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 142 - 226
Target Start/End: Complemental strand, 34583158 - 34583074
Alignment:
142 ttgtcgactctttattagagttttgttgttacctggagggttattgggagagtgccattggtagccatggcaaaaattgagttaa 226  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||    
34583158 ttgtcgactctttattagagttttgttgttatctggagggttattgggagagtgacattggtcgccatggcaaaaattgagttaa 34583074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University