View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_475 (Length: 233)
Name: NF11737A_low_475
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_475 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 36 - 213
Target Start/End: Original strand, 4664155 - 4664328
Alignment:
| Q |
36 |
tcaacatacatgaaactacagtctcaaatcaataagaaggttccaacagtgtcgattgcaagagtttctccaagcaccaaccaatggtggagaaccgtgc |
135 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| | ||||||||||| |||| |
|
|
| T |
4664155 |
tcaacatacatcaaactacagtctcaaatcaataagaaggtttcaacagtgtcgattgcaagagttcctccaagcaccga----tggtggagaactgtgc |
4664250 |
T |
|
| Q |
136 |
accaaaagatctcgatcagaagaagcaatgagtttaaccatgaagtcttcacaatagttacctttgtgaagggtataa |
213 |
Q |
| |
|
||||||||||||||||| |||||||||| ||| |||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
4664251 |
accaaaagatctcgatcggaagaagcaacgagcttaaccatgaagtcttcacaatagttgcctttgtgaaggatataa |
4664328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University