View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_48 (Length: 432)
Name: NF11737A_low_48
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_48 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 310
Target Start/End: Original strand, 179448 - 179743
Alignment:
| Q |
15 |
atggacatcacagacatggcggtttattttgattctctcctttcaattaatctcatcaataccaccagctcaaagttccatattcatgtagcccttatcc |
114 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
179448 |
atgggcatcacagatatggcggtttattcagattctctcctttcaattaatctcatcactaccaccagttcaaagttccatattcatgcggccctaatcc |
179547 |
T |
|
| Q |
115 |
aagacatcagagacaagctttctctaaagaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
214 |
Q |
| |
|
|||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
179548 |
aagatatcagagacaagctttctctaaggaatttttcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaat |
179647 |
T |
|
| Q |
215 |
gtcagatatcaacgtcctaatacaccagttgcctccggatgagctacgccctttgttgaagattgatgcagcaggaaccttgtttctgagatctta |
310 |
Q |
| |
|
||||||| ||||||| ||||||||||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
179648 |
gtcagatgtcaacgttctaatacaccagtcgcctccggatgaactctgccctttgttgaagaatgatgcagcaggaaccttgttcctgagatctta |
179743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 387 - 432
Target Start/End: Original strand, 21695315 - 21695360
Alignment:
| Q |
387 |
tgtgtcaatatttttcatttctaattagatgacaagaaaaatgata |
432 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
21695315 |
tgtgtcaatatttttcatttcgaattagatgacaagaaaaatgata |
21695360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University