View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_480 (Length: 231)
Name: NF11737A_low_480
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_480 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 16 - 217
Target Start/End: Complemental strand, 29408626 - 29408425
Alignment:
| Q |
16 |
gaacaatattgctcattgcaatcatatttaagccacacatcattgatgaagttgaccatcttagcgcaaatcaccatagctaacttttttcttttgtagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29408626 |
gaacaatattgctcattgcaatcatatttaagccacacatcattaatgaagttgaccatcttagcgcaaatcaccatagctaacttttttcttttgtagg |
29408527 |
T |
|
| Q |
116 |
aaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattccagtcctcactctatagccggatgtcc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29408526 |
aaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattccagtcctcactctatagcctaatgtcc |
29408427 |
T |
|
| Q |
216 |
at |
217 |
Q |
| |
|
|| |
|
|
| T |
29408426 |
at |
29408425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 109 - 190
Target Start/End: Original strand, 29456102 - 29456183
Alignment:
| Q |
109 |
ttgtaggaaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataatctacaaagtttattcca |
190 |
Q |
| |
|
|||||| ||||| ||||||| || || |||||||||||||||||||||| ||||| || ||||||||||||| ||||||| |
|
|
| T |
29456102 |
ttgtagaaaattcttaaaccagattgcagacatttttggatatcttttgatgccattattgtaatctacaaagtatattcca |
29456183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 74 - 190
Target Start/End: Complemental strand, 29425821 - 29425705
Alignment:
| Q |
74 |
tcttagcgcaaatcaccatagctaacttttttcttttgtaggaaatttctaaaccatatggctgacatttttggatatcttttgagaccatttttataat |
173 |
Q |
| |
|
|||||||| |||||||||| |||| |||| | |||||| ||||| | ||||||| |||||||||||||||||||||||||| |||| || |||| |
|
|
| T |
29425821 |
tcttagcgtgaatcaccatatgcaactattttatgttgtagaaaattcttgaaccatacagctgacatttttggatatcttttgaggccatcattgtaat |
29425722 |
T |
|
| Q |
174 |
ctacaaagtttattcca |
190 |
Q |
| |
|
||| |||| ||||||| |
|
|
| T |
29425721 |
ctatgaagtatattcca |
29425705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University