View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_482 (Length: 231)
Name: NF11737A_low_482
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_482 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 34 - 212
Target Start/End: Original strand, 40866236 - 40866414
Alignment:
| Q |
34 |
atagaaaagatcatcaaagtgcagaagggcctaactctttcaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
133 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866236 |
atagataagatcatcaaagtgcagaagggcctaactcttccaattacttgtgtgccaagccatgtacttcatattttcaattcagtacaactcaaaattt |
40866335 |
T |
 |
| Q |
134 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaat |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40866336 |
gatttaacctacctgttaggtgagcaaaggtcaaatgactctgataattaaatgtctctgcttgtctatgttggctaat |
40866414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University